| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.003415 |
| Chromosome: | chromosome 1 |
| Location: | 786427 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g004124 | (1 of 3) 3.2.1.8 - Endo-1,4-beta-xylanase | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTCTTATTAGGCCCCT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 861 |
| LEAP-Seq percent confirming: | 88.2353 |
| LEAP-Seq n confirming: | 75 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCGGAGATTAAGCACACA |
| Suggested primer 2: | GTAGTGTGGCCGATCAAGGT |