| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.003576 |
| Chromosome: | chromosome 8 |
| Location: | 689930 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g360200 | DUR3,DUR3A | Urea active transporter; (1 of 3) PTHR11819:SF94 - SODIUM-DEPENDENT MULTIVITAMIN TRANSPORTER-RELATED | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCCAGATCATGGCAATGAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 823 |
| LEAP-Seq percent confirming: | 97.1326 |
| LEAP-Seq n confirming: | 271 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCTCCAGGTGTCTCTGG |
| Suggested primer 2: | GCTCAACCACTGCATAGCAA |