| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.003862 |
| Chromosome: | chromosome 7 |
| Location: | 2363830 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g328250 | Pumilio-family RNA binding protein; (1 of 2) K17943 - pumilio RNA-binding family (PUM) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACAGGGAAGGAAAGAACAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 96.7914 |
| LEAP-Seq n confirming: | 181 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTACCCACAGCTTCAGAGG |
| Suggested primer 2: | GATAGCAGCACATCAGCCAA |