| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.003901 |
| Chromosome: | chromosome 3 |
| Location: | 4236951 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g174100 | (1 of 1) IPR013122//IPR015928 - Polycystin cation channel, PKD1/PKD2 // Aconitase/3-isopropylmalate dehydratase, swivel | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACTAGAGCAAGCGCTGGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 713 |
| LEAP-Seq percent confirming: | 86.3497 |
| LEAP-Seq n confirming: | 563 |
| LEAP-Seq n nonconfirming: | 89 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGGGCAGTGTGTATGATG |
| Suggested primer 2: | GTGGCAGGAACGGAAATAAA |