| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004111 |
| Chromosome: | chromosome 16 |
| Location: | 887102 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g648200 | CYP744C1,CYP35 | (1 of 3) K01832 - thromboxane-A synthase (TBXAS1, CYP5A); Cytochrome P450, CYP3 superfamily | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGCCATCCTCCAAGCCAC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 791 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 44 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACTTTTGCCATGGGTACT |
| Suggested primer 2: | GTGCTTGCTAGTGAATGCGA |