| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.004118 |
| Chromosome: | chromosome 6 |
| Location: | 8873953 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g310850 | (1 of 12) IPR003439//IPR003593//IPR027417 - ABC transporter-like // AAA+ ATPase domain // P-loop containing nucleoside triphosphate hydrolase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTGATGCGATGCCGGTGGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 897 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 111 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAAGATGCTTGCCATCAA |
| Suggested primer 2: | TGCTTGTTGTATGGAGAGCG |