| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.004129 |
| Chromosome: | chromosome 6 |
| Location: | 5730702 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g287000 | (1 of 1) PTHR31495//PTHR31495:SF0 - FAMILY NOT NAMED // PEROXYGENASE 1-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCGCCGGCCCCACTGGC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 510 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 227 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACAGGGTGTGTGGGGTGT |
| Suggested primer 2: | CATACACACACGTTTTCCGC |