Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.004134 |
Chromosome: | chromosome 1 |
Location: | 741038 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g003850 | CYP1,CYP747A1 | Cytochrome P450, CYP197 superfamily; (1 of 19) 1.14.14.1 - Unspecific monooxygenase / Xenobiotic monooxygenase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAACCCAAGCACGACACCACC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 620 |
LEAP-Seq percent confirming: | 98.4925 |
LEAP-Seq n confirming: | 392 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTCAAGCCTCAAACCTCCAG |
Suggested primer 2: | GGTCTTGTGATTGTGGCCTT |