| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004267 |
| Chromosome: | chromosome 14 |
| Location: | 1522332 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618500 | (1 of 2) IPR006502//IPR011333//IPR011705 - Protein of unknown function PDDEXK-like // POZ domain // BTB/Kelch-associated | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCGCCTACCCTCCGGCACT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1282 |
| LEAP-Seq percent confirming: | 91.0 |
| LEAP-Seq n confirming: | 182 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCTGAGCTGTGTGCTGC |
| Suggested primer 2: | GCCCCTCCACTATATCCCAT |