| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.004300 |
| Chromosome: | chromosome 12 |
| Location: | 4941149 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g525600 | (1 of 8) IPR001810//IPR006553 - F-box domain // Leucine-rich repeat, cysteine-containing subtype | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCTGCCGCAGCCCTTGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 528 |
| LEAP-Seq percent confirming: | 99.0196 |
| LEAP-Seq n confirming: | 101 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACACACACACACCGT |
| Suggested primer 2: | ACAGAAACGGGAACAACAGC |