| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.004305 |
| Chromosome: | chromosome 4 |
| Location: | 3363526 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227400 | FRE1 | (1 of 2) 1.16.1.7 - Ferric-chelate reductase (NADH) / NADH:Fe(3+)-EDTA reductase; Ferric-chelate reductase/ oxidoreductase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTTGTCCCCGCGAGGGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1490 |
| LEAP-Seq percent confirming: | 96.6216 |
| LEAP-Seq n confirming: | 1001 |
| LEAP-Seq n nonconfirming: | 35 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGAGTAACAGCAGACCGGA |
| Suggested primer 2: | CATGCGGGTACATGACGTAG |