| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004459 |
| Chromosome: | chromosome 10 |
| Location: | 1331762 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g427700 | HEL47 | (1 of 1) PTHR24031:SF235 - DEAD-BOX ATP-DEPENDENT RNA HELICASE 37-RELATED; DEAD box ATP-dependent RNA helicase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTTCACCTGCCGACGATCTA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1457 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 789 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAGGATCGTCATAGGGC |
| Suggested primer 2: | CAGCTGACATCAGGTAGGCA |