Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.004592 |
Chromosome: | chromosome 10 |
Location: | 2569012 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g436850 | (1 of 7) 2.4.1.255 - Protein O-GlcNAc transferase / OGTase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACGATATACCGGAGGGAAC |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1316 |
LEAP-Seq percent confirming: | 99.0734 |
LEAP-Seq n confirming: | 1283 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTTCCCGCTCGAACTACAG |
Suggested primer 2: | TCGATGCAACTGAGACAAGG |