| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004648 |
| Chromosome: | chromosome 9 |
| Location: | 1245167 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399550 | (1 of 1) PTHR10857//PTHR10857:SF11 - COPINE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGGTGTGAACGGTCTGGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1376 |
| LEAP-Seq percent confirming: | 84.2605 |
| LEAP-Seq n confirming: | 621 |
| LEAP-Seq n nonconfirming: | 116 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCTCCTTCACTTGACTTC |
| Suggested primer 2: | CAATAGGCGAAGTAGCTGGC |