| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004653 |
| Chromosome: | chromosome 11 |
| Location: | 3313196 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480200 | (1 of 4) IPR006597 - Sel1-like repeat | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTACTGAGGGCATGCAGCCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1334 |
| LEAP-Seq percent confirming: | 99.4898 |
| LEAP-Seq n confirming: | 2925 |
| LEAP-Seq n nonconfirming: | 15 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGCTGCCTACGTGCTGAC |
| Suggested primer 2: | AGCCTTGAAGTGGGGGTAGT |