| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.004676 |
| Chromosome: | chromosome 3 |
| Location: | 8023830 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g201450 | (1 of 70) 4.6.1.1 - Adenylate cyclase / ATP pyrophosphate-lyase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACTGAGGCGGCCGACAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1285 |
| LEAP-Seq percent confirming: | 99.8876 |
| LEAP-Seq n confirming: | 889 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGTCACCTGATGACAACC |
| Suggested primer 2: | TAGATGACGACGCAGCAATC |