| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.005717 |
| Chromosome: | chromosome 5 |
| Location: | 3197467 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g239750 | ARS13 | (1 of 2) IPR002591//IPR017849//IPR017850 - Type I phosphodiesterase/nucleotide pyrophosphatase/phosphate transferase // Alkaline phosphatase-like, alpha/beta/alpha // Alkaline-phosphatase-like, core domain; Arylsulfatase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATTACTCATGGGTCCCTG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 794 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGGTAGGTGAGAGCCTTGC |
| Suggested primer 2: | AAAGACGTGCAAATCAAGGG |