Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.005773 |
Chromosome: | chromosome 10 |
Location: | 1327055 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g427700 | HEL47 | (1 of 1) PTHR24031:SF235 - DEAD-BOX ATP-DEPENDENT RNA HELICASE 37-RELATED; DEAD box ATP-dependent RNA helicase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGACGACCGCGCACAGGAA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1299 |
LEAP-Seq percent confirming: | 99.8147 |
LEAP-Seq n confirming: | 1616 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACGCCAGCATAACAGCAG |
Suggested primer 2: | CAGAAAGGCATGAGAGAGCC |