| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.006214 |
| Chromosome: | chromosome 10 |
| Location: | 2555880 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g436800 | (1 of 2) PF01833//PF07691//PF10162 - IPT/TIG domain (TIG) // PA14 domain (PA14) // G8 domain (G8) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACGGATTTGGGTGGTGGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1415 |
| LEAP-Seq percent confirming: | 98.1142 |
| LEAP-Seq n confirming: | 1925 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCAGGATTAGGCAGAAGG |
| Suggested primer 2: | TGGAGTGTCCTGCAGTCAAG |