| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.006224 |
| Chromosome: | chromosome 1 |
| Location: | 6242051 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g044650 | (1 of 1) PF00168//PF17047 - C2 domain (C2) // Synaptotagmin-like mitochondrial-lipid-binding domain (SMP_LBD) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAAGTGGTGCGGAGACCCC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 679 |
| LEAP-Seq percent confirming: | 96.6667 |
| LEAP-Seq n confirming: | 261 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCCTCCCATCCAAGTTAC |
| Suggested primer 2: | TCACTGTAAGCGATGCCTTG |