| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.006560 |
| Chromosome: | chromosome 12 |
| Location: | 4112713 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518000 | SCA2,SECA2 | (1 of 1) PF01043//PF07517 - SecA preprotein cross-linking domain (SecA_PP_bind) // SecA DEAD-like domain (SecA_DEAD); Chloroplast-associated SecA protein | MULTIPLE_SPLICE_VARIANTS |
| g12774 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGAGCGGCTCTGAAACAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1213 |
| LEAP-Seq percent confirming: | 98.9455 |
| LEAP-Seq n confirming: | 1126 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAACACGGACAAGGCTCT |
| Suggested primer 2: | TTGATATTCAGGGGCGGTAG |