| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.006896 |
| Chromosome: | chromosome 2 |
| Location: | 5432449 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g107550 | CVL2 | Fe2+/Mn2+ transporter, VIT1/CCC1 family; (1 of 2) PF01988 - VIT family (VIT1) | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTGCCACGAGGGAATGCG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1327 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 278 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGTTGCAATGTTGCTAGGT |
| Suggested primer 2: | CGTGCTGCAGTTACGACATT |