| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.007009 |
| Chromosome: | chromosome 3 |
| Location: | 7530171 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205300 | EXN7 | (1 of 1) IPR000104//IPR002562//IPR012337 - Antifreeze protein, type I // 3'-5' exonuclease domain // Ribonuclease H-like domain; 3'-5' exonuclease | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCTGGCAACGGCCCATGAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 717 |
| LEAP-Seq percent confirming: | 97.1591 |
| LEAP-Seq n confirming: | 171 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCCAAAGTTACACAAGCGT |
| Suggested primer 2: | GACGGCATGCACATGTTTAC |