| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.007127 |
| Chromosome: | chromosome 10 |
| Location: | 3759660 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446650 | HEL46,MER | (1 of 1) K15271 - ATP-dependent DNA helicase HFM1/MER3 [EC:3.6.4.12] (HFM1, MER3); conserved protein with DEAD/DEAH box helicase domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGGTGGCAGAGCTGCAGAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1353 |
| LEAP-Seq percent confirming: | 90.9091 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTAGCCAGGTGAGCCTCTG |
| Suggested primer 2: | AAGTCAAAAAGGTCCAGGCA |