| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.007292 |
| Chromosome: | chromosome 10 |
| Location: | 5200838 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456900 | FPN4 | (1 of 2) PTHR12103//PTHR12103:SF21 - CYTOSOLIC PURINE 5-NUCLEOTIDASE-RELATED // IMP-GMP SPECIFIC 5-NUCLEOTIDASE, PUTATIVE-RELATED; Purine 5'-nucleotidase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGTCGACACACACGCGCTGC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1082 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 60 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGACACAAGCATACACACC |
| Suggested primer 2: | GTCATGTTGTTTGGGTGCAG |