| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.007292 |
| Chromosome: | chromosome 13 |
| Location: | 4187202 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g592200 | GLT1,GSN1 | Glutamate synthase, NADH-dependent; (1 of 1) 1.4.1.14 - Glutamate synthase (NADH) / NADH-glutamate synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTTGCGGGAGATCACCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 934 |
| LEAP-Seq percent confirming: | 78.125 |
| LEAP-Seq n confirming: | 275 |
| LEAP-Seq n nonconfirming: | 77 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATCCCCGTCACTAACAGT |
| Suggested primer 2: | GGTCAGGTAGTAGGCGGTCA |