Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.SG0182.007378 |
Chromosome: | chromosome 6 |
Location: | 6372465 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g292150 | (1 of 2) PF13499//PF13833 - EF-hand domain pair (EF-hand_7) // EF-hand domain pair (EF-hand_8) | 3'UTR | |
g6768 | MULTIPLE_SPLICE_VARIANTS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTTGCTGATGTCGAAAAA |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 638 |
LEAP-Seq percent confirming: | 97.479 |
LEAP-Seq n confirming: | 116 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTTTTGGGACTGCACTGTT |
Suggested primer 2: | AAGGCCGGTATGTTCATCTG |