| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.007643 |
| Chromosome: | chromosome 7 |
| Location: | 6062513 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g355200 | ORC5 | Origin recognition complex subunit 5; (1 of 1) PTHR12705//PTHR12705:SF0 - ORIGIN RECOGNITION COMPLEX SUBUNIT 5 // ORIGIN RECOGNITION COMPLEX SUBUNIT 5 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGGTGCTGCAGGCTGCAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 880 |
| LEAP-Seq percent confirming: | 96.7347 |
| LEAP-Seq n confirming: | 474 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATCGAGACCCACAACTTGG |
| Suggested primer 2: | TACCGTGGTGTGGTGAGAAA |