| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.007713 |
| Chromosome: | chromosome 3 |
| Location: | 1522478 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g152100 | XRN2 | 5' to 3' exoribonuclease; (1 of 1) IPR004859//IPR027073//IPR029060 - Putative 5-3 exonuclease // 5'-3' exoribonuclease // PIN domain-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACTGCGGGGCCGAGAGGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1336 |
| LEAP-Seq percent confirming: | 94.4262 |
| LEAP-Seq n confirming: | 576 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATGGGAGTGAGTGGAGGTG |
| Suggested primer 2: | TGTGTGTGTGTGTGTGAGGG |