| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.007809 |
| Chromosome: | chromosome 16 |
| Location: | 5892240 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677250 | TEH5 | (1 of 6) 3.1.2.2 - Palmitoyl-CoA hydrolase / Long-chain fatty-acyl-CoA hydrolase; Thioesterase-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTAGGTGAAGAGACCCGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1478 |
| LEAP-Seq percent confirming: | 99.8055 |
| LEAP-Seq n confirming: | 513 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTTCGGGGATCATTCAGT |
| Suggested primer 2: | CTGTAATCATGGGCCGTCTT |