| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.008215 |
| Chromosome: | chromosome 10 |
| Location: | 1246051 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g426700 | CYP739A4,CYP28 | (1 of 1) 1.14.13.109 - Abieta-7,13-dien-18-ol hydroxylase / CYP720B1; Cytochrome P450, CYP197 superfamily | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAAACACGATGGCGCGTGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 661 |
| LEAP-Seq percent confirming: | 98.3193 |
| LEAP-Seq n confirming: | 117 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGGTGAAGCTGCTACTGG |
| Suggested primer 2: | GTCGTCAGACAGCACACCAC |