| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.008579 |
| Chromosome: | chromosome 2 |
| Location: | 4112685 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g097800 | HLA3,MRP1 | (1 of 18) 3.6.3.44 - Xenobiotic-transporting ATPase / Steroid-transporting ATPase; Bicarbonate ABC transporter | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACCGATTGGGCTGCGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 574 |
| LEAP-Seq percent confirming: | 95.1219 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCACCGTTGGACAGGATCT |
| Suggested primer 2: | CTACCTGACCCAGGACTCCA |