Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.008787 |
Chromosome: | chromosome 16 |
Location: | 6313451 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g674500 | ABCA4 | ABC transporter 4; (1 of 14) 3.6.3.25 - Sulfate-transporting ATPase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGCCCCGAGACCACCTTT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 525 |
LEAP-Seq percent confirming: | 89.0756 |
LEAP-Seq n confirming: | 106 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCACACACACACCTACCTGG |
Suggested primer 2: | CACACCGTCACAAACGAAAC |