| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.008839 |
| Chromosome: | chromosome 3 |
| Location: | 5433531 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g185050 | FAP53,CFAP53 | Flagellar Associated Protein 53; (1 of 1) PTHR31183:SF1 - COILED-COIL DOMAIN-CONTAINING PROTEIN 11 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCCTGAGCGCACCGAGGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1060 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 64 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTTCTTCGAGCAACGGAC |
| Suggested primer 2: | TATCCTAGCGCCGATGAAAC |