| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.009134 |
| Chromosome: | chromosome 9 |
| Location: | 2191456 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393100 | (1 of 8) PF01697 - Glycosyltransferase family 92 (Glyco_transf_92) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCCCGCTGCCAAGGACTGG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1236 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 467 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATGAGTGAGCGGGTATG |
| Suggested primer 2: | GCTGTAGTGATTTCGCGTCA |