Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.009660 |
Chromosome: | chromosome 1 |
Location: | 243054 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g001550 | CIF3,TIF3A,TIF3 | (1 of 1) K02520 - translation initiation factor IF-3 (infC, MTIF3); Chloroplast translation initiation factor 3 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTGAGGGCGAGGGCGGG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 667 |
LEAP-Seq percent confirming: | 95.8042 |
LEAP-Seq n confirming: | 274 |
LEAP-Seq n nonconfirming: | 12 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCACAGCTACACCCCAATCT |
Suggested primer 2: | CCTTACACCCGCTAGCTCAC |