| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.009674 |
| Chromosome: | chromosome 16 |
| Location: | 2780801 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662951 | (1 of 1) PF06985//PF12796//PF13637 - Heterokaryon incompatibility protein (HET) (HET) // Ankyrin repeats (3 copies) (Ank_2) // Ankyrin repeats (many copies) (Ank_4) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCCAAATTATGATTGACAT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1006 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 88 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACGCTACTACCCCGAT |
| Suggested primer 2: | ACCTACACCCACACCCACAC |