| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.009696 |
| Chromosome: | chromosome 6 |
| Location: | 6752015 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g294650 | AGT1 | Alanine-glyoxylate transaminase; (1 of 2) K00830 - alanine-glyoxylate transaminase / serine-glyoxylate transaminase / serine-pyruvate transaminase (AGXT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGGAGAGCCGCGCCAGCA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 561 |
| LEAP-Seq percent confirming: | 98.1481 |
| LEAP-Seq n confirming: | 53 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTAGGAAACCACCTGCCCT |
| Suggested primer 2: | CGTGTGACAAAGGGAAGGTT |