| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.009745 |
| Chromosome: | chromosome 3 |
| Location: | 2654283 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g160953 | (1 of 1) 3.1.27.1//3.6.3.44 - Ribonuclease T(2) / Ribonuclease T2 // Xenobiotic-transporting ATPase / Steroid-transporting ATPase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAGCGAGTGCACGGACGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 788 |
| LEAP-Seq percent confirming: | 78.3333 |
| LEAP-Seq n confirming: | 141 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | CGGTGTGTGTGTGTGTGTGT |