| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.009952 |
| Chromosome: | chromosome 12 |
| Location: | 4014199 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g517000 | MAPKKK7 | (1 of 55) PTHR23257//PTHR23257:SF394 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED; Mitogen-Activated Protein Kinase Kinase Kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTCTGCCAAGGCCGCACTA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1486 |
| LEAP-Seq percent confirming: | 94.4257 |
| LEAP-Seq n confirming: | 559 |
| LEAP-Seq n nonconfirming: | 33 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCCAGGGACATGTTGTTTA |
| Suggested primer 2: | GTAGTGTGGGATGACGGCTT |