| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.010138 |
| Chromosome: | chromosome 1 |
| Location: | 7423246 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g053300 | AIH1 | Agmatine iminohydrolase; (1 of 2) 3.5.3.12 - Agmatine deiminase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCTGCGGCATGCTCAGAC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1185 |
| LEAP-Seq percent confirming: | 98.6066 |
| LEAP-Seq n confirming: | 920 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATTCGTCCCTGATACGCAC |
| Suggested primer 2: | GTGCTCCTTCCTTGTTGCTC |