| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.SG0182.010231 |
| Chromosome: | chromosome 6 |
| Location: | 2015929 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g264250 | FAO6 | FAD-dependent oxidoreductase; (1 of 3) 5.5.1.19 - Lycopene beta-cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCATGCGCGGCATGCAA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 929 |
| LEAP-Seq percent confirming: | 80.5263 |
| LEAP-Seq n confirming: | 306 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACGTGTCATTGGTGTGTG |
| Suggested primer 2: | CTGACTCCAAGCCCTCACTC |