Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.SG0182.010278 |
Chromosome: | chromosome 2 |
Location: | 5402404 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g107350 | DHC4 | (1 of 3) IPR003593//IPR004273//IPR011704//IPR013602//IPR024317//IPR024743//IPR026983//IPR027417 - AAA+ ATPase domain // Dynein heavy chain domain // ATPase, dynein-related, AAA domain // Dynein heavy chain, domain-2 // Dynein heavy chain, P-loop containing D4 domain // Dynein heavy chain, coiled coil stalk // Dynein heavy chain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCAACTAGCTATGAGCCTG |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1426 |
LEAP-Seq percent confirming: | 96.124 |
LEAP-Seq n confirming: | 496 |
LEAP-Seq n nonconfirming: | 20 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCAGCAGCAGAAGTATGAG |
Suggested primer 2: | GATGCCAACACAACACAAGG |