| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.SG0182.010280 |
| Chromosome: | chromosome 13 |
| Location: | 2829640 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583100 | (1 of 1) 2.4.99.12 - Lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase / Lipid IV(A) KDO transferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACGGCTAGCCTGGCGCAGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1052 |
| LEAP-Seq percent confirming: | 98.7578 |
| LEAP-Seq n confirming: | 159 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCCCATCATACGTCCCAAT |
| Suggested primer 2: | TGGAGCAGTATTGAACGCAG |