| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.010320 |
| Chromosome: | chromosome 2 |
| Location: | 5514200 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g108350 | (1 of 24) PTHR10641 - MYB-LIKE DNA-BINDING PROTEIN MYB | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGGGTTTGAGCGACATC |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1331 |
| LEAP-Seq percent confirming: | 99.6815 |
| LEAP-Seq n confirming: | 1565 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTCGGCTCTCAAACACAA |
| Suggested primer 2: | GAGGCTCTGGATTGCATCA |