Insertion cassette: | pMJ013b |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.SG0182.010320 |
Chromosome: | chromosome 2 |
Location: | 5514197 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g108350 | (1 of 24) PTHR10641 - MYB-LIKE DNA-BINDING PROTEIN MYB | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGTGATACGTGCATAGAT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 470 |
LEAP-Seq percent confirming: | 98.1132 |
LEAP-Seq n confirming: | 156 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTCGGCTCTCAAACACAA |
Suggested primer 2: | GAGGCTCTGGATTGCATCA |