| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.010429 |
| Chromosome: | chromosome 7 |
| Location: | 4226059 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g342000 | (1 of 1) PF00651//PF12847 - BTB/POZ domain (BTB) // Methyltransferase domain (Methyltransf_18) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGGGCGGGTGGTTGCGTT |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 633 |
| LEAP-Seq percent confirming: | 98.8372 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAGTCCACCATCCGAGTTG |
| Suggested primer 2: | GCACACACACCAATCACACA |