| Insertion cassette: | pMJ013b |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.SG0182.010495 |
| Chromosome: | chromosome 10 |
| Location: | 3700627 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446100 | TRX6,TRXY,TRXY1 | Thioredoxin y, chloroplastic; (1 of 1) PTHR10438:SF280 - THIOREDOXIN Y1, CHLOROPLASTIC-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACTCTTGAGGGGTACAGGGA |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1093 |
| LEAP-Seq percent confirming: | 99.6885 |
| LEAP-Seq n confirming: | 320 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGGCTTGCCCTTGATACTG |
| Suggested primer 2: | TGAGTGTGGAGTGGAACCAA |