| Insertion cassette: | pMJ013b |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.SG0182.010503 |
| Chromosome: | chromosome 10 |
| Location: | 5112920 |
| Confidence (%): | 75 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g456300 | NAC2,MBD1 | (1 of 1) IPR003107//IPR013026//IPR019734 - HAT (Half-A-TPR) repeat // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat; PsbD mRNA maturation factor Nac2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCGCGGTCGACTCCCCAAG |
| Internal bar code: | |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1271 |
| LEAP-Seq percent confirming: | 97.0588 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACGTTGTGCTGGGGAAAC |
| Suggested primer 2: | GAATGAAGCAGCAGGGCTAC |