Insertion cassette: | pMJ013b |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.SG0182.010503 |
Chromosome: | chromosome 10 |
Location: | 5112922 |
Confidence (%): | 75 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g456300 | NAC2,MBD1 | (1 of 1) IPR003107//IPR013026//IPR019734 - HAT (Half-A-TPR) repeat // Tetratricopeptide repeat-containing domain // Tetratricopeptide repeat; PsbD mRNA maturation factor Nac2 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCTGCATGAACTGGCTACT |
Internal bar code: | |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 565 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAATGAAGCAGCAGGGCTAC |
Suggested primer 2: | ATACGTTGTGCTGGGGAAAC |